IB Biology HL D1.3 Mutation and gene editing Questions

Practise IB Biology HL D1.3 by classifying mutations, predicting molecular consequences and evaluating gene knockout and CRISPR evidence.

46 questions in this syllabus scope, with question parts counted together.

Syllabus
First assessment 2025
Course
Biology HL
Level
HL

Exam analysis

HL · 2010–2025
Papers with this topic20 / 117in the analysed sample
Latest appearanceNovember 2025
Tagged question parts26
Paper types5

Most tested objectives

  1. D1.3.2—Base substitution consequences5 papers
  2. D1.3.4—Causes of mutation4 papers
  3. D1.3.7—Mutation as source of variation4 papers
  4. D1.3.1—Gene mutations3 papers
  5. D1.3.8 (HL)—Gene knockout3 papers

Common question formats

  • Definition or recall
  • Process explanation
  • Comparison
  • Evaluation
  • Diagram interpretation
  • Calculation

Recent exam appearances

November 2025Paper 2 HL · TZ3Q10(c)[ 7 ]
November 2025Paper 2 HL · TZ1Q5(c)[ 2 ]
November 2025Paper 1A HL · TZ3Q11[ 1 ]

117 papers analysed · Tagging incomplete

Exam points

  • define gene mutations and distinguish substitution, insertion and deletion in DNA sequences
  • deduce codon and amino-acid outcomes of substitutions, including silent, missense and nonsense changes
  • link a substitution to altered haemoglobin structure, red-cell shape and sickle-cell function
  • explain chemical mutagen effects and evaluate NNK tumour evidence using dose and model limits
  • explain random mutation as a source of new alleles and population variation
  • use gene-knockout phenotypes or p53-knockout mice to investigate gene function and drug effects
  • apply CRISPR-Cas9 to target dystrophin mutations by replacing, inserting or deleting DNA
  • identify conserved protein stretches from sequence-alignment evidence

Covered syllabus points

D1.3.1—Gene mutationsD1.3.2—Base substitution consequencesD1.3.3—Insertion and deletion consequencesD1.3.4—Causes of mutationD1.3.5—Randomness in mutationD1.3.6—Consequences in germ vs. somatic cellsD1.3.7—Mutation as source of variationD1.3.8 (HL)—Gene knockoutD1.3.9 (HL)—CRISPR-Cas9 gene editingD1.3.10 (HL)—Conserved sequences

Exam points

  • Define a gene mutation as a change in the DNA nucleotide or base sequence.
  • Identify and distinguish substitution, insertion, and deletion as gene-mutation types at the DNA sequence level.

Question 1

[Maximum number: 1]

Two DNA sequences are shown.
Sequence 1 CACGTGGACTGAGGACTCCTC
Sequence 2 CACGTGGACTGAGGACACCTC
What type of mutation is occurring between sequence 1 and sequence 2 ?

A

Substitution

B

Polyploidy

C

Insertion

D

Deletion

Exam points

  • Deduce the codon and amino-acid consequence of a specified DNA base substitution using the genetic code.
  • Distinguish silent, missense, and nonsense outcomes that can follow from a changed codon.
  • Link a substitution from DNA and primary structure to altered haemoglobin function or sickle-cell phenotype.

Question 1

[Maximum number: 1]

What change causes sickle cell anemia?

A

One amino acid less in a polypeptide of hemoglobin

B

A mutation leading to an extra codon in the genome

C

Thymine replacing adenine in DNA

D

Failure of tRNA to correctly transcribe the sequence of codons from mRNA

No public sample questions are available for this syllabus point yet.

Exam points

  • Explain how environmental mutagens, including chemical mutagens and radiation, can change DNA base sequences or increase mutation frequency.
  • Use dose-response or exposure evidence to assess a chemical mutagen claim, limiting conclusions to the tested dose, organism and exposure route.

Question 1

[Maximum number: 2]

Fish are harvested from many estuaries where a river flows into the sea.

Explain how chemical substances can cause cancer.

Exam points

  • Explain how mutations produce new alleles and contribute to genetic variation in a population.

Question 1

[Maximum number: 1]

Which statements are characteristics of alleles?

I. Alleles differ significantly in number of base pairs.
II. Alleles are specific forms of a gene.
III. New alleles are formed by mutation.

A

I and II only

B

I and III only

C

II and III only

D

I, II and III

Exam points

  • Explain that gene knockout makes a specific gene non-functional so its function can be investigated from the resulting phenotype or model response.

Question 1

[Maximum number: 1]

What is gene knockout used for?

A

Increasing protein production by editing a gene

B

Investigating the function of a gene by replacing it to make it inoperative

C

Identifying the presence of a gene by editing it to produce a different protein

D

Editing a gene to initiate cell death

Exam points

  • Explain how CRISPR-Cas9 targets a DNA sequence for editing and how replacing, inserting or deleting DNA can change the resulting protein.

Question 1

[Maximum number: 3]

Duchenne muscular dystrophy (DMD) is a sex-linked genetic disorder caused by a recessive allele resulting from mutations in the X-linked dystrophin gene. This causes the degeneration of cardiac and skeletal muscle. These mutations can include deletions, insertions and base substitution mutations.

Explain ways in which CRISPR-Cas9 gene editing could be used to change the mutated dystrophin protein produced.

Exam points

  • Identify the longest conserved amino-acid stretch by comparing aligned proteins across species.

Question 1

[Maximum number: 1]

The genetic code is the information encoded within the mRNA sequence that is translated into proteins by living cells. The codon table is shown.

Table for Question 1 — IB Biology HL

The first part of the cytochrome c protein sequence alignment of mold fungus (Neurospora), horse (Equus), human (Homo), corn (Zea) and rice (Oryza) is shown using the amino acids as a one letter code.

Figure for Question 1 — IB Biology HL

Identify the longest amino acid sequence where there are no differences amongst the five genera.